Part:BBa_K2342002:Experience

This experience page is provided so that any user may enter their experience using this part.
Please enter how you used this part and how it worked out.

Applications of BBa_K2342002

This part encodes for Cellulose binding domain (CBM3) from Clostridium thermocellum. In our project we used this part together with DCD-1L peptide and linker to immobilize of cellulose nano fibers.

For more details on the production and usage of this part in our project please check the composite part page: BBa_K2342006, BBa_K2342007, BBa_K2342008

Promoter information

For the expression of protein of interest in our project pET28a(+) vector contains a T7lac promoter (TAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTC) which consists of the T7 promoter and downstream of that there is the lac operator sequence. In addition, the vector contains the gene lacI, which encodes for the lac repressor (LacI) that binds to the lac operator. This is inducible with addition of isopropyl-β-D-thiogalactopyranoside (IPTG) to expression culture, since IPTG induces T7 RNA polymerase promoter leading to expression of gene of interest in plasmid. (ref. Novagen pET System Manual: https://research.fhcrc.org/content/dam/stripe/hahn/methods/biochem/pet.pdf )

User Reviews

UNIQ8a9d570b76016d4a-partinfo-00000000-QINU UNIQ8a9d570b76016d4a-partinfo-00000001-QINU